大约有 45,000 项符合查询结果（耗时：0.0263秒） [XML]
Regular expression matching a multiline block of text
...PS
Edit (proof that this works):
text = """> some_Varying_TEXT
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA
> some_Varying_TEXT2
DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""
import re
regex = re.compile(r'^>([^\n\r]+...
Minimum and maximum date
...sMax field like in .net... gist.github.com/QueueHammer/cb9bf736b81029d65485fb30ad01918d
– QueueHammer
Jun 28 '16 at 15:23
1
...
Convert blob URL to normal URL
...rl look like: src="blob:https%3A//www.youtube.com/44f26667-03f1-4978-9eed-af0cbf11dd67" (in Chrome)
– bhh1988
Sep 3 '14 at 15:53
...
When is CRC more appropriate to use than MD5/SHA1?
...h('crc32', 'The quick brown fox jumped over the lazy dog.'); echoes "413a86af", what is 8 character long string. Btw, it is 32bit number stored in HEX format. For example, "sha256" has 256bits hash, again stored as HEX, what gives 64 character long string.
– Martin
...
Why does the PHP json_encode function convert UTF-8 strings to hexadecimal entities?
...
answered May 11 '13 at 14:46
John SeverinsonJohn Severinson
3,87511 gold badge1212 silver badges55 bronze badges
...
Modify Address Bar URL in AJAX App to Match Current State
...
Similar technique is used by fb while navigating through pages of different groups. You have a left nav column in which different groups are mentioned. When you click on a particular group name the url changes and only the content of the main content pan...
How to extract img src, title and alt from html using php? [duplicate]
... => <img src="http://www.gravatar.com/avatar/df299babc56f0a79678e567e87a09c31?s=32&d=identicon&r=PG" height=32 width=32 alt="gravatar image" />
[4] => <img class="vote-up" src="/content/img/vote-arrow-up.png" alt="vote up" title="This was helpful (click again to un...
How to remove a package from Laravel using composer?
...ollowing version of composer:
Composer version 1.0-dev (7b13507dd4d3b93578af7d83fbf8be0ca686f4b5) 2014-12-11 21:52:29
share
|
improve this answer
|
follow
|
...
How to declare a friend assembly?
...5de2c105e848974a3d210e938b0a56103c0662901efd6b78"+
"0ee6dbe977923d46a8fda18fb25c65dd73b149a5cd9f3100668b56649932dadd8cf5be52eb1dce"+
"ad5cedbf")]
The public key is retrieved by running
sn -Tp path\to\test\assembly.dll
Alternatively, get it from the .snk file:
sn -p MyStrongnameKey.snk public.p...
Regular expression for a string that does not start with a sequence
...\" fill=\"none\" xmlns=\"http://www.w3.org/2000/svg\"\u003e\u003cpath d=\"M46.1709 9.17788C46.1709 8.26454 46.2665 7.94324 47.1084 7.58816C47.4091 7.46349 47.7169 7.36433 48.0099 7.26993C48.9099 6.97997 49.672 6.73443 49.672 5.93063C49.672 5.22043 48.9832 4.61182 48.1414 4.61182C47.4335 4.61182 46.7...