大约有 43,000 项符合查询结果（耗时：0.0375秒） [XML]
How to get the absolute coordinates of a view
...own bug that getLocationOnScreen gives a null pointer exception in Android v1.5 (the platform I'm coding for), but testing in v2.1 didn't work any better. Both methods gave me 0s for everything. I included a code snippet above.
– Steve Haley
Feb 9 '10 at 12:23
...
What does the WPF star do (Width=“100*”)
...s of the column need
<ColumnDefinition Width="Auto"/>
//Fixed width: 100 pixels
<ColumnDefinition Width="100"/>
Hope that helps!
share
|
improve this answer
|
f...
How to add new column to MYSQL table?
...t;query(
"ALTER TABLE $your_table ADD $your_column VARCHAR(100) CHARACTER SET utf8 NOT NULL " //you can add positioning phraze: "AFTER My_another_column"
);}
share
|
im...
jQuery - setting the selected value of a select control via its text description
...
Select by description for jQuery v1.6+
var text1 = 'Two';
$("select option").filter(function() {
//may want to use $.trim in here
return $(this).text() == text1;
}).prop('selected', true);
<script src="https://cdnjs.cloudflare.com/ajax/libs/...
Reading string from input with space character? [duplicate]
...
Use:
fgets (name, 100, stdin);
100 is the max length of the buffer. You should adjust it as per your need.
Use:
scanf ("%[^\n]%*c", name);
The [] is the scanset character. [^\n] tells that while the input is not a newline ('\n') take inp...
How to round up to the nearest 10 (or 100 or X)?
... actually also works when x is a vector:
> roundUp(c(0.0023, 3.99, 10, 1003))
[1] 1e-02 1e+01 1e+01 1e+04
..but if you want to round to a "nice" number, you first need to define what a "nice" number is. The following lets us define "nice" as a vector with nice base values from 1 to 10. The def...
How to draw polygons on an HTML5 canvas?
...d');
ctx.fillStyle = '#f00';
ctx.beginPath();
ctx.moveTo(0, 0);
ctx.lineTo(100,50);
ctx.lineTo(50, 100);
ctx.lineTo(0, 90);
ctx.closePath();
ctx.fill();
share
|
improve this answer
|
...
How can I force a long string without any blank to be wrapped?
...
for block elements:
<textarea style="width:100px; word-wrap:break-word;">
ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>
for inline elements:
<span style="width:100px; word-wrap:break-word; display:i...
Simulate low network connectivity for Android [closed]
...
This tab has been removed in Android Studio v1.5
– Lou Morda
Jan 5 '16 at 3:55
@S1LENT ...
How can I recover the return value of a function passed to multiprocessing.Process?
...ses
q = Queue()
processes = []
rets = []
for _ in range(0, 100):
p = Process(target=add_helper, args=(q, 1, 2))
processes.append(p)
p.start()
for p in processes:
ret = q.get() # will block
rets.append(ret)
for p in processes:
p....